Skip to main navigation Skip to search Skip to main content

Nucleotide changes around the splicing acceptor of intron 24 in the factor VIII gene and its impact on splicing

  • Jyh Pyng Gau*
  • , Chih Cheng Chen
  • , Hui Chi Hsu
  • , Chao Hung Ho
  • , Wing Keung Chau
  • , Jie Yu You
  • , Yuan Bin Yu
  • *Corresponding author for this work
  • Veterans General Hospital-Taipei
  • Chang Gung Memorial Hospital

Research output: Contribution to journalJournal Article peer-review

Abstract

Nucleotide 6724 of the factor VIII gene harbors a polymorphism of low frequency. A report from Taiwan claimed that 97.9% of the 83 alleles examined were of the A nucleotide at this position, which is quite different to the data from Western populations. Furthermore, this nucleotide is the start of exon 25, located in juxtaposition to the splicing acceptor of intron 24. We wonder if the nucleotide change at this location might have any effect on the splicing process of pre-mRNA. Using genomic DNA with direct sequencing of the polymerase chain reaction-amplified intron 24/exon 25 junction site, we found that 59 of the 60 patient samples were of the GTG sequence at nucleotides 6724-6726. The polymorphism is similar between populations in Taiwan and Western countries. The sequence of intron 24 around the splicing acceptor was always TCCAACTCTATTGCCCTCAG (-20 to -1), except for one hemophiliac patient who had a mutation in which the absolute consensus AG doublet of the intron 24 splicing acceptor changed to the AA dinucleotide. Owing to the mutation, exon 24 was erroneously spliced to exon 26, and exon 25 was skipped. This finding further testifies to the importance of the invariant AG dinucleotide in the example of the factor VIII gene.

Original languageEnglish
Pages (from-to)53-56
Number of pages4
JournalBlood Coagulation and Fibrinolysis
Volume17
Issue number1
DOIs
StatePublished - 01 2006
Externally publishedYes

Keywords

  • Exon skipping
  • Factor VIII gene
  • Genetic polymorphism
  • Hemophilia A
  • Intron
  • Splicing site

Fingerprint

Dive into the research topics of 'Nucleotide changes around the splicing acceptor of intron 24 in the factor VIII gene and its impact on splicing'. Together they form a unique fingerprint.

Cite this