Abstract
Nucleotide 6724 of the factor VIII gene harbors a polymorphism of low frequency. A report from Taiwan claimed that 97.9% of the 83 alleles examined were of the A nucleotide at this position, which is quite different to the data from Western populations. Furthermore, this nucleotide is the start of exon 25, located in juxtaposition to the splicing acceptor of intron 24. We wonder if the nucleotide change at this location might have any effect on the splicing process of pre-mRNA. Using genomic DNA with direct sequencing of the polymerase chain reaction-amplified intron 24/exon 25 junction site, we found that 59 of the 60 patient samples were of the GTG sequence at nucleotides 6724-6726. The polymorphism is similar between populations in Taiwan and Western countries. The sequence of intron 24 around the splicing acceptor was always TCCAACTCTATTGCCCTCAG (-20 to -1), except for one hemophiliac patient who had a mutation in which the absolute consensus AG doublet of the intron 24 splicing acceptor changed to the AA dinucleotide. Owing to the mutation, exon 24 was erroneously spliced to exon 26, and exon 25 was skipped. This finding further testifies to the importance of the invariant AG dinucleotide in the example of the factor VIII gene.
| Original language | English |
|---|---|
| Pages (from-to) | 53-56 |
| Number of pages | 4 |
| Journal | Blood Coagulation and Fibrinolysis |
| Volume | 17 |
| Issue number | 1 |
| DOIs | |
| State | Published - 01 2006 |
| Externally published | Yes |
Keywords
- Exon skipping
- Factor VIII gene
- Genetic polymorphism
- Hemophilia A
- Intron
- Splicing site
Fingerprint
Dive into the research topics of 'Nucleotide changes around the splicing acceptor of intron 24 in the factor VIII gene and its impact on splicing'. Together they form a unique fingerprint.Cite this
- APA
- Author
- BIBTEX
- Harvard
- Standard
- RIS
- Vancouver